Review



plko 1 scrambled control shrna vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm40921794-168-20-27
    Average 93 stars, based on 175 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: pLKO.1 lentiviral vector + ANXA4 shRNA: shRNA-81: GCCTTGAAGATGACATTCGCT , Horizon Discovery Biosciences Limited , TRCN0000056281. .. Scramble pLKO.1 shRNA control , Sarbassov et al. , Addgene plasmid #1864, RRID:Addgene_1864. .. hELF3 (NM_004433) in pLenti C-Myc-DDK-P2A-Puro , OriGene Technologies , RC200631L3.

    Control:

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: pLKO.1 lentiviral vector + ANXA4 shRNA: shRNA-81: GCCTTGAAGATGACATTCGCT , Horizon Discovery Biosciences Limited , TRCN0000056281. .. Scramble pLKO.1 shRNA control , Sarbassov et al. , Addgene plasmid #1864, RRID:Addgene_1864. .. hELF3 (NM_004433) in pLenti C-Myc-DDK-P2A-Puro , OriGene Technologies , RC200631L3.

    Plasmid Preparation:

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: pLKO.1 lentiviral vector + ANXA4 shRNA: shRNA-81: GCCTTGAAGATGACATTCGCT , Horizon Discovery Biosciences Limited , TRCN0000056281. .. Scramble pLKO.1 shRNA control , Sarbassov et al. , Addgene plasmid #1864, RRID:Addgene_1864. .. hELF3 (NM_004433) in pLenti C-Myc-DDK-P2A-Puro , OriGene Technologies , RC200631L3.



    Similar Products

    93
    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm40921794-168-20-27
    Average 93 stars, based on 1 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc scramble shrna control vector
    Scramble Shrna Control Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc12358835__pnas%2E2425621122%2Esapp-30-1-5
    Average 93 stars, based on 1 article reviews
    scramble shrna control vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc scramble plko.1 shrna control

    Scramble Plko.1 Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/plko+1/pmc11982489-400-0-13
    Average 90 stars, based on 1 article reviews
    scramble plko.1 shrna control - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc scramble plko 1 shrna control

    Scramble Plko 1 Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/pLKO%2E1+luciferase+shRNA+(Plasmid+%2330324)/pmc11982489-85-0-9
    Average 93 stars, based on 1 article reviews
    scramble plko 1 shrna control - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Millipore plko.1 plasmids containing shrnas targeting gls or scramble control

    Plko.1 Plasmids Containing Shrnas Targeting Gls Or Scramble Control, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/plko+1+vector/pm39625974-278-23-37
    Average 90 stars, based on 1 article reviews
    plko.1 plasmids containing shrnas targeting gls or scramble control - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc control shrna

    Control Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc11582751-390-21-23
    Average 93 stars, based on 1 article reviews
    control shrna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc shrna negative control

    Shrna Negative Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+plko+1+shrna+control/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm39069531-228-3-21
    Average 93 stars, based on 1 article reviews
    shrna negative control - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Scramble pLKO.1 shRNA control (further termed “scramble”) was a gift from David Sabatini (Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID:Addgene_1864). oeELF3 cells was generated by expressing human hELF3 (NM_004433) in pLenti-C-Myc-DDK-P2A-Puro (OriGene Technologies, Rockville, USA – CAT#: RC200631L3) and Luciferase (subcloned into pLenti-C-Myc-DDK-P2A-Puro expression vector). oeANXA4 cells were generated by expressing human ANXA4 (NM_001320698.2) in pcDNA3.1+/C-(K)-DYK vector (purchased from GenScript Biotech, Piscataway Township, USA – Clone-ID: OHu26294).

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture

    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Scramble pLKO.1 shRNA control , Sarbassov et al. , Addgene plasmid #1864, RRID:Addgene_1864.

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture